Review





Similar Products

94
Addgene inc mko2
mTagBFP2, mTurquoise2, Venus, <t>mKO2,</t> mCherry, mKate2, and mCardinal exhibit approximately comparable brightness across different excitation conditions. All fluorescent proteins were fused to a nuclear localisation signal. (a) Cumulative fluorescence intensity (RFU) of transiently expressed proteins in N. benthamiana, measured using standard laser lines on the Leica Stellaris 5 microscope. (b) The same measurement performed using the 405 nm or a white light laser on Stellaris 8, with excitation wavelengths set just below each protein’s emission peak. Fluorescent proteins are indicated below each bar chart, while laser wavelengths and power settings are shown above. Detector gain was kept at the minimum setting for all fluorescent proteins. For each condition, at least two independent images were analysed. Mean fluorescence intensity per nucleus was plotted as bar charts with overlaid points (each dot represents one nucleus). (c, e) Expected fluorescence intensity based on FPbase.org data (excitation × brightness), shown for (c) Stellaris 5 and (e) Stellaris 8, calculated for (a) and (d) standard laser lines, and (b) and (f) white light laser excitation. Among the tested fluorescent proteins, Venus, mKO2 and mKate2 were selected for stable transformation in potato (highlighted in yellow across all charts). (d, f) Brightness of fluorescent proteins measured in S. tuberosum (potato) leaves (d) using standard laser lines or (f) the white light laser, as described in panels (a‒b). Brightness is shown for one transgenic line per fluorescent protein. Analysis of a second transgenic line gave similar results (results available on Zenodo: 10.5281/zenodo.17600476).
Mko2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mko2/product/Addgene inc
Average 94 stars, based on 1 article reviews
mko2 - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

93
Addgene inc plko 1 trc lentiviral shrna system
mTagBFP2, mTurquoise2, Venus, <t>mKO2,</t> mCherry, mKate2, and mCardinal exhibit approximately comparable brightness across different excitation conditions. All fluorescent proteins were fused to a nuclear localisation signal. (a) Cumulative fluorescence intensity (RFU) of transiently expressed proteins in N. benthamiana, measured using standard laser lines on the Leica Stellaris 5 microscope. (b) The same measurement performed using the 405 nm or a white light laser on Stellaris 8, with excitation wavelengths set just below each protein’s emission peak. Fluorescent proteins are indicated below each bar chart, while laser wavelengths and power settings are shown above. Detector gain was kept at the minimum setting for all fluorescent proteins. For each condition, at least two independent images were analysed. Mean fluorescence intensity per nucleus was plotted as bar charts with overlaid points (each dot represents one nucleus). (c, e) Expected fluorescence intensity based on FPbase.org data (excitation × brightness), shown for (c) Stellaris 5 and (e) Stellaris 8, calculated for (a) and (d) standard laser lines, and (b) and (f) white light laser excitation. Among the tested fluorescent proteins, Venus, mKO2 and mKate2 were selected for stable transformation in potato (highlighted in yellow across all charts). (d, f) Brightness of fluorescent proteins measured in S. tuberosum (potato) leaves (d) using standard laser lines or (f) the white light laser, as described in panels (a‒b). Brightness is shown for one transgenic line per fluorescent protein. Analysis of a second transgenic line gave similar results (results available on Zenodo: 10.5281/zenodo.17600476).
Plko 1 Trc Lentiviral Shrna System, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 trc lentiviral shrna system/product/Addgene inc
Average 93 stars, based on 1 article reviews
plko 1 trc lentiviral shrna system - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc plko 1 trc addgene
mTagBFP2, mTurquoise2, Venus, <t>mKO2,</t> mCherry, mKate2, and mCardinal exhibit approximately comparable brightness across different excitation conditions. All fluorescent proteins were fused to a nuclear localisation signal. (a) Cumulative fluorescence intensity (RFU) of transiently expressed proteins in N. benthamiana, measured using standard laser lines on the Leica Stellaris 5 microscope. (b) The same measurement performed using the 405 nm or a white light laser on Stellaris 8, with excitation wavelengths set just below each protein’s emission peak. Fluorescent proteins are indicated below each bar chart, while laser wavelengths and power settings are shown above. Detector gain was kept at the minimum setting for all fluorescent proteins. For each condition, at least two independent images were analysed. Mean fluorescence intensity per nucleus was plotted as bar charts with overlaid points (each dot represents one nucleus). (c, e) Expected fluorescence intensity based on FPbase.org data (excitation × brightness), shown for (c) Stellaris 5 and (e) Stellaris 8, calculated for (a) and (d) standard laser lines, and (b) and (f) white light laser excitation. Among the tested fluorescent proteins, Venus, mKO2 and mKate2 were selected for stable transformation in potato (highlighted in yellow across all charts). (d, f) Brightness of fluorescent proteins measured in S. tuberosum (potato) leaves (d) using standard laser lines or (f) the white light laser, as described in panels (a‒b). Brightness is shown for one transgenic line per fluorescent protein. Analysis of a second transgenic line gave similar results (results available on Zenodo: 10.5281/zenodo.17600476).
Plko 1 Trc Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 trc addgene/product/Addgene inc
Average 93 stars, based on 1 article reviews
plko 1 trc addgene - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc knockdown
mTagBFP2, mTurquoise2, Venus, <t>mKO2,</t> mCherry, mKate2, and mCardinal exhibit approximately comparable brightness across different excitation conditions. All fluorescent proteins were fused to a nuclear localisation signal. (a) Cumulative fluorescence intensity (RFU) of transiently expressed proteins in N. benthamiana, measured using standard laser lines on the Leica Stellaris 5 microscope. (b) The same measurement performed using the 405 nm or a white light laser on Stellaris 8, with excitation wavelengths set just below each protein’s emission peak. Fluorescent proteins are indicated below each bar chart, while laser wavelengths and power settings are shown above. Detector gain was kept at the minimum setting for all fluorescent proteins. For each condition, at least two independent images were analysed. Mean fluorescence intensity per nucleus was plotted as bar charts with overlaid points (each dot represents one nucleus). (c, e) Expected fluorescence intensity based on FPbase.org data (excitation × brightness), shown for (c) Stellaris 5 and (e) Stellaris 8, calculated for (a) and (d) standard laser lines, and (b) and (f) white light laser excitation. Among the tested fluorescent proteins, Venus, mKO2 and mKate2 were selected for stable transformation in potato (highlighted in yellow across all charts). (d, f) Brightness of fluorescent proteins measured in S. tuberosum (potato) leaves (d) using standard laser lines or (f) the white light laser, as described in panels (a‒b). Brightness is shown for one transgenic line per fluorescent protein. Analysis of a second transgenic line gave similar results (results available on Zenodo: 10.5281/zenodo.17600476).
Knockdown, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/knockdown/product/Addgene inc
Average 93 stars, based on 1 article reviews
knockdown - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc shrna targeting sequence
A Immunoblot of s-EVs from mouse lung tissues after fractionation by sucrose density ultracentrifugation and probed for ALIX, GLUD1 and TOMM40. Experiment was repeated independently three times with similar results. B Transmission electron microscopy (TEM) images of s-EVs isolated from lung tissues from Sftpc cre Gprc5a fl/fl and Sftpc cre Gprc5a wt/wt mice. Scale bar, 200 nm. C Size distributions of s-EVs from lungs of Sftpc cre Gprc5a fl/fl and Sftpc cre Gprc5a wt/wt mice (means ± SEM, n = 3 replicates per group). D , E ( D ) Immunoblot of cell lysates and s-EV lysates prepared from Sftpc cre Gprc5a wt/wt and Sftpc cre Gprc5a fl/fl lungs. S-EVs lysates were probed for GLUD1, TOMM40 and ALIX. Cell lysates were probed for GLUD1, TOMM40, ALIX and β-actin. E Quantification of relative GLUD1 and TOMM40 densities (normalized to ALIX) in s-EVs (means ± SEM, n = 4 mice). F TEM images of s-EVs isolated from cell culture supernatants of knockdown GPRC5A (shGPRC5A-#1 and #2) or control (shCTL) A549 cells. Scale bar, 100 nm. G Size distributions of s-EVs from cell culture supernatants of knockdown GPRC5A (shGPRC5A-#1 and #2) or control (shCTL) A549 cells (means ± SEM, n = 3 replicates per group). H Immunoblot of cell lysates and s-EV lysates prepared from supernatants of the same number of knockdown GPRC5A (shGPRC5A #1 and #2) and control (shCTL) A549 cells. S-EVs lysates were probed for GLUD1, TOMM40 and ALIX. Cell lysates were probed for GLUD1, TOMM40, ALIX and β-actin. I Quantification of relative GLUD1 and TOMM40 densities (normalized to ALIX) in s-EVs (means ± SEM, n = 3 independent experiments). J A549 cells stably expressing MitoDsRed and GFP-CD63 were infected with <t>GPRC5A-shRNA</t> (shGPRC5A), or <t>control</t> <t>lentiviral</t> constructs (shCTL). S-EVs were collected from indicated culture supernatants and analyzed by flow cytometry. K Percentage of MitoDsRed + particles in all CD63 + s-EVs and ( L ) absolute number of CD63 + MitoDsRed + s-EVs (normalized to cell number) were quantified (means ± SEM, n = 3 independent experiments). Statistical significance was assessed using a two-tailed unpaired Student’s t test in ( E , I , and K – L ). Source data are provided as a Source Data file.
Shrna Targeting Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna targeting sequence/product/Addgene inc
Average 93 stars, based on 1 article reviews
shrna targeting sequence - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc bajar
A Immunoblot of s-EVs from mouse lung tissues after fractionation by sucrose density ultracentrifugation and probed for ALIX, GLUD1 and TOMM40. Experiment was repeated independently three times with similar results. B Transmission electron microscopy (TEM) images of s-EVs isolated from lung tissues from Sftpc cre Gprc5a fl/fl and Sftpc cre Gprc5a wt/wt mice. Scale bar, 200 nm. C Size distributions of s-EVs from lungs of Sftpc cre Gprc5a fl/fl and Sftpc cre Gprc5a wt/wt mice (means ± SEM, n = 3 replicates per group). D , E ( D ) Immunoblot of cell lysates and s-EV lysates prepared from Sftpc cre Gprc5a wt/wt and Sftpc cre Gprc5a fl/fl lungs. S-EVs lysates were probed for GLUD1, TOMM40 and ALIX. Cell lysates were probed for GLUD1, TOMM40, ALIX and β-actin. E Quantification of relative GLUD1 and TOMM40 densities (normalized to ALIX) in s-EVs (means ± SEM, n = 4 mice). F TEM images of s-EVs isolated from cell culture supernatants of knockdown GPRC5A (shGPRC5A-#1 and #2) or control (shCTL) A549 cells. Scale bar, 100 nm. G Size distributions of s-EVs from cell culture supernatants of knockdown GPRC5A (shGPRC5A-#1 and #2) or control (shCTL) A549 cells (means ± SEM, n = 3 replicates per group). H Immunoblot of cell lysates and s-EV lysates prepared from supernatants of the same number of knockdown GPRC5A (shGPRC5A #1 and #2) and control (shCTL) A549 cells. S-EVs lysates were probed for GLUD1, TOMM40 and ALIX. Cell lysates were probed for GLUD1, TOMM40, ALIX and β-actin. I Quantification of relative GLUD1 and TOMM40 densities (normalized to ALIX) in s-EVs (means ± SEM, n = 3 independent experiments). J A549 cells stably expressing MitoDsRed and GFP-CD63 were infected with <t>GPRC5A-shRNA</t> (shGPRC5A), or <t>control</t> <t>lentiviral</t> constructs (shCTL). S-EVs were collected from indicated culture supernatants and analyzed by flow cytometry. K Percentage of MitoDsRed + particles in all CD63 + s-EVs and ( L ) absolute number of CD63 + MitoDsRed + s-EVs (normalized to cell number) were quantified (means ± SEM, n = 3 independent experiments). Statistical significance was assessed using a two-tailed unpaired Student’s t test in ( E , I , and K – L ). Source data are provided as a Source Data file.
Bajar, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bajar/product/Addgene inc
Average 93 stars, based on 1 article reviews
bajar - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc pll3 7m clover geminin 1 110 ires mko2 cdt 30 120
A Immunoblot of s-EVs from mouse lung tissues after fractionation by sucrose density ultracentrifugation and probed for ALIX, GLUD1 and TOMM40. Experiment was repeated independently three times with similar results. B Transmission electron microscopy (TEM) images of s-EVs isolated from lung tissues from Sftpc cre Gprc5a fl/fl and Sftpc cre Gprc5a wt/wt mice. Scale bar, 200 nm. C Size distributions of s-EVs from lungs of Sftpc cre Gprc5a fl/fl and Sftpc cre Gprc5a wt/wt mice (means ± SEM, n = 3 replicates per group). D , E ( D ) Immunoblot of cell lysates and s-EV lysates prepared from Sftpc cre Gprc5a wt/wt and Sftpc cre Gprc5a fl/fl lungs. S-EVs lysates were probed for GLUD1, TOMM40 and ALIX. Cell lysates were probed for GLUD1, TOMM40, ALIX and β-actin. E Quantification of relative GLUD1 and TOMM40 densities (normalized to ALIX) in s-EVs (means ± SEM, n = 4 mice). F TEM images of s-EVs isolated from cell culture supernatants of knockdown GPRC5A (shGPRC5A-#1 and #2) or control (shCTL) A549 cells. Scale bar, 100 nm. G Size distributions of s-EVs from cell culture supernatants of knockdown GPRC5A (shGPRC5A-#1 and #2) or control (shCTL) A549 cells (means ± SEM, n = 3 replicates per group). H Immunoblot of cell lysates and s-EV lysates prepared from supernatants of the same number of knockdown GPRC5A (shGPRC5A #1 and #2) and control (shCTL) A549 cells. S-EVs lysates were probed for GLUD1, TOMM40 and ALIX. Cell lysates were probed for GLUD1, TOMM40, ALIX and β-actin. I Quantification of relative GLUD1 and TOMM40 densities (normalized to ALIX) in s-EVs (means ± SEM, n = 3 independent experiments). J A549 cells stably expressing MitoDsRed and GFP-CD63 were infected with <t>GPRC5A-shRNA</t> (shGPRC5A), or <t>control</t> <t>lentiviral</t> constructs (shCTL). S-EVs were collected from indicated culture supernatants and analyzed by flow cytometry. K Percentage of MitoDsRed + particles in all CD63 + s-EVs and ( L ) absolute number of CD63 + MitoDsRed + s-EVs (normalized to cell number) were quantified (means ± SEM, n = 3 independent experiments). Statistical significance was assessed using a two-tailed unpaired Student’s t test in ( E , I , and K – L ). Source data are provided as a Source Data file.
Pll3 7m Clover Geminin 1 110 Ires Mko2 Cdt 30 120, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pll3 7m clover geminin 1 110 ires mko2 cdt 30 120/product/Addgene inc
Average 93 stars, based on 1 article reviews
pll3 7m clover geminin 1 110 ires mko2 cdt 30 120 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

Image Search Results


mTagBFP2, mTurquoise2, Venus, mKO2, mCherry, mKate2, and mCardinal exhibit approximately comparable brightness across different excitation conditions. All fluorescent proteins were fused to a nuclear localisation signal. (a) Cumulative fluorescence intensity (RFU) of transiently expressed proteins in N. benthamiana, measured using standard laser lines on the Leica Stellaris 5 microscope. (b) The same measurement performed using the 405 nm or a white light laser on Stellaris 8, with excitation wavelengths set just below each protein’s emission peak. Fluorescent proteins are indicated below each bar chart, while laser wavelengths and power settings are shown above. Detector gain was kept at the minimum setting for all fluorescent proteins. For each condition, at least two independent images were analysed. Mean fluorescence intensity per nucleus was plotted as bar charts with overlaid points (each dot represents one nucleus). (c, e) Expected fluorescence intensity based on FPbase.org data (excitation × brightness), shown for (c) Stellaris 5 and (e) Stellaris 8, calculated for (a) and (d) standard laser lines, and (b) and (f) white light laser excitation. Among the tested fluorescent proteins, Venus, mKO2 and mKate2 were selected for stable transformation in potato (highlighted in yellow across all charts). (d, f) Brightness of fluorescent proteins measured in S. tuberosum (potato) leaves (d) using standard laser lines or (f) the white light laser, as described in panels (a‒b). Brightness is shown for one transgenic line per fluorescent protein. Analysis of a second transgenic line gave similar results (results available on Zenodo: 10.5281/zenodo.17600476).

Journal: bioRxiv

Article Title: Reliable quantification of multiplexed genetically encoded biosensors responsiveness in plant tissues

doi: 10.64898/2026.03.13.711581

Figure Lengend Snippet: mTagBFP2, mTurquoise2, Venus, mKO2, mCherry, mKate2, and mCardinal exhibit approximately comparable brightness across different excitation conditions. All fluorescent proteins were fused to a nuclear localisation signal. (a) Cumulative fluorescence intensity (RFU) of transiently expressed proteins in N. benthamiana, measured using standard laser lines on the Leica Stellaris 5 microscope. (b) The same measurement performed using the 405 nm or a white light laser on Stellaris 8, with excitation wavelengths set just below each protein’s emission peak. Fluorescent proteins are indicated below each bar chart, while laser wavelengths and power settings are shown above. Detector gain was kept at the minimum setting for all fluorescent proteins. For each condition, at least two independent images were analysed. Mean fluorescence intensity per nucleus was plotted as bar charts with overlaid points (each dot represents one nucleus). (c, e) Expected fluorescence intensity based on FPbase.org data (excitation × brightness), shown for (c) Stellaris 5 and (e) Stellaris 8, calculated for (a) and (d) standard laser lines, and (b) and (f) white light laser excitation. Among the tested fluorescent proteins, Venus, mKO2 and mKate2 were selected for stable transformation in potato (highlighted in yellow across all charts). (d, f) Brightness of fluorescent proteins measured in S. tuberosum (potato) leaves (d) using standard laser lines or (f) the white light laser, as described in panels (a‒b). Brightness is shown for one transgenic line per fluorescent protein. Analysis of a second transgenic line gave similar results (results available on Zenodo: 10.5281/zenodo.17600476).

Article Snippet: N7 localization signal together with mTurquoise2, Venus, and mKate2 (plasmids pHG128, pHG132, and pHG154, respectively) were kindly provided by Hassan Ghareeb ( ). mTagBFP2 (plasmid pJL1-mTagBFP2; Addgene #102638; ( )), mKO2 (plasmid pTU-A-005; Addgene #124412; ( )), mCardinal (plasmid mCardinal-pBAD; Addgene #54800; ( )), and miRFP713 (plasmid pmiRFP713-N1; Addgene #136559; ( )) were obtained from Addgene.

Techniques: Fluorescence, Microscopy, Transformation Assay, Transgenic Assay

(a) Selected images of an xyλ image show crosstalk between fluorescent proteins localized in different cellular compartments. From left to right: images taken at emission peak of EGFP (510 nm), Venus (525 nm) and mKO2 (560 nm). Spectral unmixing results using different reference spectra: (b) FPbase obtained reference spectra, and (c) experimentally recorded reference spectra. From left to right: images obtained after spectral unmixing showing EGFP, Venus and mKO2 channel. Examples of remaining crosstalk from mKO2 in the nucleus and Venus in the plastids after unmixing are pointed with red and blue arrows, respectively. Scale bar: 25 µm.

Journal: bioRxiv

Article Title: Reliable quantification of multiplexed genetically encoded biosensors responsiveness in plant tissues

doi: 10.64898/2026.03.13.711581

Figure Lengend Snippet: (a) Selected images of an xyλ image show crosstalk between fluorescent proteins localized in different cellular compartments. From left to right: images taken at emission peak of EGFP (510 nm), Venus (525 nm) and mKO2 (560 nm). Spectral unmixing results using different reference spectra: (b) FPbase obtained reference spectra, and (c) experimentally recorded reference spectra. From left to right: images obtained after spectral unmixing showing EGFP, Venus and mKO2 channel. Examples of remaining crosstalk from mKO2 in the nucleus and Venus in the plastids after unmixing are pointed with red and blue arrows, respectively. Scale bar: 25 µm.

Article Snippet: N7 localization signal together with mTurquoise2, Venus, and mKate2 (plasmids pHG128, pHG132, and pHG154, respectively) were kindly provided by Hassan Ghareeb ( ). mTagBFP2 (plasmid pJL1-mTagBFP2; Addgene #102638; ( )), mKO2 (plasmid pTU-A-005; Addgene #124412; ( )), mCardinal (plasmid mCardinal-pBAD; Addgene #54800; ( )), and miRFP713 (plasmid pmiRFP713-N1; Addgene #136559; ( )) were obtained from Addgene.

Techniques:

(a–c) Reference channels used to generate the unmixing matrix for individual fluorescent proteins: (a) EGFP, (b) pt-Venus, and (c) mKO2-N7. Input (d) and output (e) of channel separation for co-expressed EGFP, pt-Venus, and mKO2. Examples of crosstalk from mKO2 in the nucleus, Venus in the plastids and EGFP in the cytoplasm before unmixing are pointed with red, blue and yellow arrows, respectively. Scale bar: 25 µm.

Journal: bioRxiv

Article Title: Reliable quantification of multiplexed genetically encoded biosensors responsiveness in plant tissues

doi: 10.64898/2026.03.13.711581

Figure Lengend Snippet: (a–c) Reference channels used to generate the unmixing matrix for individual fluorescent proteins: (a) EGFP, (b) pt-Venus, and (c) mKO2-N7. Input (d) and output (e) of channel separation for co-expressed EGFP, pt-Venus, and mKO2. Examples of crosstalk from mKO2 in the nucleus, Venus in the plastids and EGFP in the cytoplasm before unmixing are pointed with red, blue and yellow arrows, respectively. Scale bar: 25 µm.

Article Snippet: N7 localization signal together with mTurquoise2, Venus, and mKate2 (plasmids pHG128, pHG132, and pHG154, respectively) were kindly provided by Hassan Ghareeb ( ). mTagBFP2 (plasmid pJL1-mTagBFP2; Addgene #102638; ( )), mKO2 (plasmid pTU-A-005; Addgene #124412; ( )), mCardinal (plasmid mCardinal-pBAD; Addgene #54800; ( )), and miRFP713 (plasmid pmiRFP713-N1; Addgene #136559; ( )) were obtained from Addgene.

Techniques:

Channel separation enables distinction of cytoplasmic (blue, PVY-GFP) and organellar (yellow, chloroplasts tagged with pt-Venus, and red, nuclei tagged with mKO2-N7) movements in infected cells. Bottom right: tracked movement of selected plastids through time course aligned to the first image (0 s). Scale bar: 25 µm.

Journal: bioRxiv

Article Title: Reliable quantification of multiplexed genetically encoded biosensors responsiveness in plant tissues

doi: 10.64898/2026.03.13.711581

Figure Lengend Snippet: Channel separation enables distinction of cytoplasmic (blue, PVY-GFP) and organellar (yellow, chloroplasts tagged with pt-Venus, and red, nuclei tagged with mKO2-N7) movements in infected cells. Bottom right: tracked movement of selected plastids through time course aligned to the first image (0 s). Scale bar: 25 µm.

Article Snippet: N7 localization signal together with mTurquoise2, Venus, and mKate2 (plasmids pHG128, pHG132, and pHG154, respectively) were kindly provided by Hassan Ghareeb ( ). mTagBFP2 (plasmid pJL1-mTagBFP2; Addgene #102638; ( )), mKO2 (plasmid pTU-A-005; Addgene #124412; ( )), mCardinal (plasmid mCardinal-pBAD; Addgene #54800; ( )), and miRFP713 (plasmid pmiRFP713-N1; Addgene #136559; ( )) were obtained from Addgene.

Techniques: Infection

A Immunoblot of s-EVs from mouse lung tissues after fractionation by sucrose density ultracentrifugation and probed for ALIX, GLUD1 and TOMM40. Experiment was repeated independently three times with similar results. B Transmission electron microscopy (TEM) images of s-EVs isolated from lung tissues from Sftpc cre Gprc5a fl/fl and Sftpc cre Gprc5a wt/wt mice. Scale bar, 200 nm. C Size distributions of s-EVs from lungs of Sftpc cre Gprc5a fl/fl and Sftpc cre Gprc5a wt/wt mice (means ± SEM, n = 3 replicates per group). D , E ( D ) Immunoblot of cell lysates and s-EV lysates prepared from Sftpc cre Gprc5a wt/wt and Sftpc cre Gprc5a fl/fl lungs. S-EVs lysates were probed for GLUD1, TOMM40 and ALIX. Cell lysates were probed for GLUD1, TOMM40, ALIX and β-actin. E Quantification of relative GLUD1 and TOMM40 densities (normalized to ALIX) in s-EVs (means ± SEM, n = 4 mice). F TEM images of s-EVs isolated from cell culture supernatants of knockdown GPRC5A (shGPRC5A-#1 and #2) or control (shCTL) A549 cells. Scale bar, 100 nm. G Size distributions of s-EVs from cell culture supernatants of knockdown GPRC5A (shGPRC5A-#1 and #2) or control (shCTL) A549 cells (means ± SEM, n = 3 replicates per group). H Immunoblot of cell lysates and s-EV lysates prepared from supernatants of the same number of knockdown GPRC5A (shGPRC5A #1 and #2) and control (shCTL) A549 cells. S-EVs lysates were probed for GLUD1, TOMM40 and ALIX. Cell lysates were probed for GLUD1, TOMM40, ALIX and β-actin. I Quantification of relative GLUD1 and TOMM40 densities (normalized to ALIX) in s-EVs (means ± SEM, n = 3 independent experiments). J A549 cells stably expressing MitoDsRed and GFP-CD63 were infected with GPRC5A-shRNA (shGPRC5A), or control lentiviral constructs (shCTL). S-EVs were collected from indicated culture supernatants and analyzed by flow cytometry. K Percentage of MitoDsRed + particles in all CD63 + s-EVs and ( L ) absolute number of CD63 + MitoDsRed + s-EVs (normalized to cell number) were quantified (means ± SEM, n = 3 independent experiments). Statistical significance was assessed using a two-tailed unpaired Student’s t test in ( E , I , and K – L ). Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control

doi: 10.1038/s41467-025-66901-7

Figure Lengend Snippet: A Immunoblot of s-EVs from mouse lung tissues after fractionation by sucrose density ultracentrifugation and probed for ALIX, GLUD1 and TOMM40. Experiment was repeated independently three times with similar results. B Transmission electron microscopy (TEM) images of s-EVs isolated from lung tissues from Sftpc cre Gprc5a fl/fl and Sftpc cre Gprc5a wt/wt mice. Scale bar, 200 nm. C Size distributions of s-EVs from lungs of Sftpc cre Gprc5a fl/fl and Sftpc cre Gprc5a wt/wt mice (means ± SEM, n = 3 replicates per group). D , E ( D ) Immunoblot of cell lysates and s-EV lysates prepared from Sftpc cre Gprc5a wt/wt and Sftpc cre Gprc5a fl/fl lungs. S-EVs lysates were probed for GLUD1, TOMM40 and ALIX. Cell lysates were probed for GLUD1, TOMM40, ALIX and β-actin. E Quantification of relative GLUD1 and TOMM40 densities (normalized to ALIX) in s-EVs (means ± SEM, n = 4 mice). F TEM images of s-EVs isolated from cell culture supernatants of knockdown GPRC5A (shGPRC5A-#1 and #2) or control (shCTL) A549 cells. Scale bar, 100 nm. G Size distributions of s-EVs from cell culture supernatants of knockdown GPRC5A (shGPRC5A-#1 and #2) or control (shCTL) A549 cells (means ± SEM, n = 3 replicates per group). H Immunoblot of cell lysates and s-EV lysates prepared from supernatants of the same number of knockdown GPRC5A (shGPRC5A #1 and #2) and control (shCTL) A549 cells. S-EVs lysates were probed for GLUD1, TOMM40 and ALIX. Cell lysates were probed for GLUD1, TOMM40, ALIX and β-actin. I Quantification of relative GLUD1 and TOMM40 densities (normalized to ALIX) in s-EVs (means ± SEM, n = 3 independent experiments). J A549 cells stably expressing MitoDsRed and GFP-CD63 were infected with GPRC5A-shRNA (shGPRC5A), or control lentiviral constructs (shCTL). S-EVs were collected from indicated culture supernatants and analyzed by flow cytometry. K Percentage of MitoDsRed + particles in all CD63 + s-EVs and ( L ) absolute number of CD63 + MitoDsRed + s-EVs (normalized to cell number) were quantified (means ± SEM, n = 3 independent experiments). Statistical significance was assessed using a two-tailed unpaired Student’s t test in ( E , I , and K – L ). Source data are provided as a Source Data file.

Article Snippet: The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A : (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a : (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1 : (GCTACTTTACTCCAACTTATT), human MFN1 : (GCTCAAAGTTGTAAATGCTTT), and human MIRO2 : (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid.

Techniques: Western Blot, Fractionation, Transmission Assay, Electron Microscopy, Isolation, Cell Culture, Knockdown, Control, Stable Transfection, Expressing, Infection, shRNA, Construct, Flow Cytometry, Two Tailed Test

A – D A549 cells stably expressing GPRC5A-GFP were infected with DRP1-shRNA (shDRP1), MFN1-shRNA (shMFN1) or control lentiviral constructs (shCTL). A Confocal images of cells stained with Mitotracker Red. Scale bar, 5 μm. Right panel, enlarged region of interesting (ROI). Scale bar, 1 μm. B Quantification of mitochondrial morphology changes (means ± SEM, n = 10 cells). C Quantification of average mitochondrial length (means ± SEM, n = 10 cells). D Number of GPRC5A vesicles containing mitochondrial components per cell (means ± SEM, n = 10 cells). E – H A549 cells stably expressing GPRC5A-GFP were incubated with DMSO, Mdivi-1 or MFI8 for 6 h. E Confocal images of cells stained with Mitotracker Red. Scale bar, 5 μm. Right panels, enlarged ROI. Scale bar, 1 μm. F Quantification of mitochondrial morphology changes (means ± SEM, n = 9 cells). G Quantification of average mitochondrial length (means ± SEM, n = 9 cells). H Number of GPRC5A vesicles containing mitochondrial components per cell (means ± SEM, n = 9 cells). I A549 cells stably expressing GPRC5A-GFP and stained with EEA1, CD63 or LAMP1 antibodies. Scale bar, 5 μm. Lower panels, enlarged ROI. Scale bar, 1 μm. J Percentage of GPRC5A vesicles colocalized with EEA1, CD63 or LAMP1 per cell (means ± SEM, n = 10 cells). K A549 cells stably expressing MitoDsRed and GFP-CD63 were infected with GPRC5A-shRNA (shGPRC5A), or control lentiviral constructs (shCTL). Cells were imaged at 37°C with frames collected every 0.59 s. Scale bar, 5 μm. Right panel, the stills from videos showing colocalization of MitoDsRed and GFP-CD63. Scale bar, 1 μm. L Quantification of mitochondrial morphology changes (means ± SEM, n = 10 cells). M Number of contacts between MitoDsRed and GFP-CD63 positive structures per cell (means ± SEM, n = 12 cells). N Quantitative analysis of the duration of contacts (frames per punctum) (means ± SEM, n = 12 cells). Statistical significance was assessed using a two-tailed unpaired Student’s t test in ( C , D , G , H , J , M , N ). Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control

doi: 10.1038/s41467-025-66901-7

Figure Lengend Snippet: A – D A549 cells stably expressing GPRC5A-GFP were infected with DRP1-shRNA (shDRP1), MFN1-shRNA (shMFN1) or control lentiviral constructs (shCTL). A Confocal images of cells stained with Mitotracker Red. Scale bar, 5 μm. Right panel, enlarged region of interesting (ROI). Scale bar, 1 μm. B Quantification of mitochondrial morphology changes (means ± SEM, n = 10 cells). C Quantification of average mitochondrial length (means ± SEM, n = 10 cells). D Number of GPRC5A vesicles containing mitochondrial components per cell (means ± SEM, n = 10 cells). E – H A549 cells stably expressing GPRC5A-GFP were incubated with DMSO, Mdivi-1 or MFI8 for 6 h. E Confocal images of cells stained with Mitotracker Red. Scale bar, 5 μm. Right panels, enlarged ROI. Scale bar, 1 μm. F Quantification of mitochondrial morphology changes (means ± SEM, n = 9 cells). G Quantification of average mitochondrial length (means ± SEM, n = 9 cells). H Number of GPRC5A vesicles containing mitochondrial components per cell (means ± SEM, n = 9 cells). I A549 cells stably expressing GPRC5A-GFP and stained with EEA1, CD63 or LAMP1 antibodies. Scale bar, 5 μm. Lower panels, enlarged ROI. Scale bar, 1 μm. J Percentage of GPRC5A vesicles colocalized with EEA1, CD63 or LAMP1 per cell (means ± SEM, n = 10 cells). K A549 cells stably expressing MitoDsRed and GFP-CD63 were infected with GPRC5A-shRNA (shGPRC5A), or control lentiviral constructs (shCTL). Cells were imaged at 37°C with frames collected every 0.59 s. Scale bar, 5 μm. Right panel, the stills from videos showing colocalization of MitoDsRed and GFP-CD63. Scale bar, 1 μm. L Quantification of mitochondrial morphology changes (means ± SEM, n = 10 cells). M Number of contacts between MitoDsRed and GFP-CD63 positive structures per cell (means ± SEM, n = 12 cells). N Quantitative analysis of the duration of contacts (frames per punctum) (means ± SEM, n = 12 cells). Statistical significance was assessed using a two-tailed unpaired Student’s t test in ( C , D , G , H , J , M , N ). Source data are provided as a Source Data file.

Article Snippet: The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A : (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a : (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1 : (GCTACTTTACTCCAACTTATT), human MFN1 : (GCTCAAAGTTGTAAATGCTTT), and human MIRO2 : (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid.

Techniques: Stable Transfection, Expressing, Infection, shRNA, Control, Construct, Staining, Incubation, Two Tailed Test

A , B Binding of GPRC5A and MIRO2. (A) HEK293T cells were transfected with S-tag-HA-GPRC5A and Flag-MIRO2 expression vectors, and cell lysates were pulled down with S-tag beads and subjected to immunoblotting with anti-Flag and anti-HA antibodies. B Cell lysates of A549 were immunoprecipitated with anti-IgG and anti-MIRO2 and immunoblotted with anti-GPRC5A and anti-MIRO2 antibodies. C , D A549 cells stably expressing GPRC5A-GFP and MIRO2-mcherry were stained with Mitotracker Deep Red (MTDR) and examined by confocal microscopy. C Distribution of the intensities of GPRC5A-GFP, MIRO2-mcherry and MTDR along the direction of the white arrow in enlarged region of interesting (ROI). Scale bar, 1 μm. D Quantification of MIRO2 intensity of cytoplastic mitochondria ( n = 100) and mitochondria inside GPRC5A vesicles ( n = 70) (means ± SEM). E-G. A549 cells stably expressing GPRC5A-GFP were infected with MIRO2-shRNA (shMIRO2) or control lentiviral constructs (shCTL). E Cells were stained with Mitotracker Red and examined by confocal microscopy. Scale bar, 5 μm. Lower panel, enlarged ROI. Scale bar, 1 μm. F Quantification of mitochondrial morphology changes (means ± SEM, n = 10 cells). G Quantitative analysis of GPRC5A vesicles containing mitochondrial components per cell (means ± SEM, n = 12 cells). H TMRM staining of Sftpc cre Gprc5a wt/wt and Sftpc cre Gprc5a fl/fl AEC2s on day 3 after PBS or GW4869 treatment as detected by flow cytometry. I Quantification of percentage of TMRM low AEC2s (means ± SEM, n = 4 mice). J Quantification of TMRM intensity in AEC2s (means ± SEM, n = 4 mice). K Schematic illustrating the formation of mitochondrial components-containing endosomal vesicles through the GPRC5A-MIRO2 pathway, created in BioRender. Han, Y. ( https://BioRender.com/bygo2rn ). Statistical significance was assessed using a two-tailed unpaired Student’s t test in ( D , G ). Statistical significance was assessed using a two-way ANOVA followed by Tukey’s multiple comparisons test in ( I , J ). Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control

doi: 10.1038/s41467-025-66901-7

Figure Lengend Snippet: A , B Binding of GPRC5A and MIRO2. (A) HEK293T cells were transfected with S-tag-HA-GPRC5A and Flag-MIRO2 expression vectors, and cell lysates were pulled down with S-tag beads and subjected to immunoblotting with anti-Flag and anti-HA antibodies. B Cell lysates of A549 were immunoprecipitated with anti-IgG and anti-MIRO2 and immunoblotted with anti-GPRC5A and anti-MIRO2 antibodies. C , D A549 cells stably expressing GPRC5A-GFP and MIRO2-mcherry were stained with Mitotracker Deep Red (MTDR) and examined by confocal microscopy. C Distribution of the intensities of GPRC5A-GFP, MIRO2-mcherry and MTDR along the direction of the white arrow in enlarged region of interesting (ROI). Scale bar, 1 μm. D Quantification of MIRO2 intensity of cytoplastic mitochondria ( n = 100) and mitochondria inside GPRC5A vesicles ( n = 70) (means ± SEM). E-G. A549 cells stably expressing GPRC5A-GFP were infected with MIRO2-shRNA (shMIRO2) or control lentiviral constructs (shCTL). E Cells were stained with Mitotracker Red and examined by confocal microscopy. Scale bar, 5 μm. Lower panel, enlarged ROI. Scale bar, 1 μm. F Quantification of mitochondrial morphology changes (means ± SEM, n = 10 cells). G Quantitative analysis of GPRC5A vesicles containing mitochondrial components per cell (means ± SEM, n = 12 cells). H TMRM staining of Sftpc cre Gprc5a wt/wt and Sftpc cre Gprc5a fl/fl AEC2s on day 3 after PBS or GW4869 treatment as detected by flow cytometry. I Quantification of percentage of TMRM low AEC2s (means ± SEM, n = 4 mice). J Quantification of TMRM intensity in AEC2s (means ± SEM, n = 4 mice). K Schematic illustrating the formation of mitochondrial components-containing endosomal vesicles through the GPRC5A-MIRO2 pathway, created in BioRender. Han, Y. ( https://BioRender.com/bygo2rn ). Statistical significance was assessed using a two-tailed unpaired Student’s t test in ( D , G ). Statistical significance was assessed using a two-way ANOVA followed by Tukey’s multiple comparisons test in ( I , J ). Source data are provided as a Source Data file.

Article Snippet: The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A : (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a : (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1 : (GCTACTTTACTCCAACTTATT), human MFN1 : (GCTCAAAGTTGTAAATGCTTT), and human MIRO2 : (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid.

Techniques: Binding Assay, Transfection, Expressing, Western Blot, Immunoprecipitation, Stable Transfection, Staining, Confocal Microscopy, Infection, shRNA, Control, Construct, Flow Cytometry, Two Tailed Test